Situación del Pueblo Mapuche, Chile. : Argentina Indymedia (( i ))
CMIargentina.indymedia.org Dijimos Nunca Más. ¿Donde está Julio López?
Quienes somos Contacto Subscripciones Calendario Donaciones Publicar
en negroen blancoen rojoayuda temas

Translate this page using Google:


Sindicacion
Sindicacion


New Global Vision
versión para imprimir - envía este articulo por e-mail

Situación del Pueblo Mapuche, Chile.
Por Colectivo Des_Usa - Tuesday, Jun. 25, 2002 at 10:26 PM
sin_rodeo@inventati.org

SITUACIÓN DEL PUEBLO MAPUCHE, CHILE.

Situación del Pueblo...
fotograf_as_hist_ricas_del_pueblo_mapuche.gif, image/gif, 567x1323

El Colectivo Des_Usa publicará en dos capítulos la situación del Pueblo Mapuche basado en el Organo Oficial de la Coordinadora Mapuche Arauco Malleco llamado WEFTUN, contribuyendo así a evitar la invisibilidad del conflicto Mapuche y sus múltiples interpretaciones fundamentalmente por los medios de comunicación dominantes, dejando en claro también que existen otras organizaciones Mapuche.


LECTURA DE LA SITUACIÓN DEL PUEBLO MAPUCHE.

Según el documento “El Pueblo Mapuche y su lucha de liberación”.

“La usurpación de los territorios mapuche, la depredación sin límites del medio ambiente y la pobreza de todo un pueblo, es el resultado de una constante histórica: la acumulación de riquezas”.

Actualmente, en nuestro wall mapu, operan una gran cantidad de empresas forestales transnacionales, las cuales continúan con el arrinconamiento de las comunidades, entre ellas se encuentran: Bosques Arauco S.A., Mininco S.A., Millalemu y Volterra, entre otros. Por su parte, la hidroeléctrica ENDESA (España), que se proyecta como monopolio a nivel del continente sur, aplasta sin contemplación la vida mapuche Pehuenche. Por otro lado, las empresas de inversiones e inmobiliarias presionan a mapuches ribereños de mares, lagos y ríos para desarrollar zonas turísticas. A esto se suman, además, los diversos proyectos orientados e implementados desde el Estado para allanar el proceso de inversión capitalista en nuestras zonas, como por ejemplo la carretera de la Costa.

La transnacionalización de la economía con su correlato de acuerdos (APEC, TLC, MERCOSUR, etc...), no harán más que agravar nuestra situación, más aún cuando este proceso trae consigo la entrada de dinero del narcotráfico y con ello la corrupción y el tráfico de influencias.

El resultado, es la mantención de un estado de dominación, en donde se evidencia el compromiso del Estado chileno con un modelo de desarrollo neoliberal que condena la existencia del pueblo mapuche, lo que hemos denominado la nueva invasión, la del poder económico.

Paralelo a este proceso de inversión transnacional, se desarrolla un cuadro socio político y jurídico funcional a este, a través del Decreto Ley 2.568 y la actual Ley Indígena 19.253 cuyos fundamentos históricos y jurídicos se basan en la ocupación militar del territorio mapuche a fines del siglo XIX.

Según el documento “Planteamiento Político-Estratégico de la Coordinadora de Comunidades en Conflicto Arauco-Malleco (C.A.M.) de Marzo del 2000, se desarrolla un análisis de los sujetos involucrados en el conflicto mapuche:





a.- El Pueblo Mapuche.

Que producto del estado de dominación y dependencia, existe una gran heterogeneidad de posiciones y a la vez gran desesperanza dentro del Pueblo Mapuche, lo que se manifiesta en inmovilismo. Lo anterior, no ha permitido levantar propuestas desde una perspectiva propia, por lo que la mayoría de las organizaciones existentes persisten en actuar dentro de los límites institucionales, viendo por ende, frustradas sus aspiraciones. Contrario a esto, las movilizaciones de las comunidades en conflicto han generado un mayor nivel de conciencia de los aspectos históricos, políticos y culturales involucrados en este proceso. De esta forma hoy día existen mayores grados de organización que tiene como base las comunidades y en donde la representación la tienen los Lonkos. Más importante aún es la reactivación de elementos culturales e ideológicos mapuche que permitirán la construcción de un proyecto de liberación propio.


b.- El Estado chileno.

Ante los conflictos de tierras, el Estado privilegia los intereses políticos económicos, es decir, hace todo lo posible por mantener la estabilidad política y el crecimiento económico, aún a costa de sacrificar al Pueblo Mapuche. El Estado ha puesto a la economía como el eje ordenador de los diversos aspectos de la vida del país; con los argumentos políticos-económicos busca insertarse competitivamente en el ámbito internacional, sobre todo en el marco del proceso de transnacionalización de la economía, donde el sistema capitalista-financiero no tiene límites ni fronteras. Se sostiene que no hay otras alternativas de inversión y que las comunidades no se verán tan afectadas con las “compensaciones” que se ofrecen y que, a nuestro juicio, no resuelven en lo más mínimo las históricas demandas mapuche.

Nos resulta claro, la total complacencia que muestra el Estado chileno frente a los procesos de inversión privados que tienen como objetivo definitivo la desaparición física e ideológica de las comunidades mapuche. Esto se expresa además, en su propia política de inversión pública, que generan las condiciones necesarias para favorecer las inversiones transnacionales.

En la actual administración del Estado se persiste en la mantención de la visión indigenista en el tratamiento y relación con los pueblos originarios, en donde el Estado asume un rol tutelar y asistencialista. En este marco la política social no es el resultado de una concepción humanitaria y justa hacia nuestro Pueblo, sino, más bien es una estrategia política que tiene como objetivo amortiguar el descontento que existe respecto de nuestra realidad como pueblo oprimido; así se entiende la política de Estado en materia de pueblos indígenas, cuyo principal discurso es la “integración y el desarrollo de los indígenas al país”.

Además, la postura del Estado en los conflictos territoriales es la de hacer respetar el “Estado de Derecho”, impulsando la represión a través de los desalojos, detenciones y medidas drásticas como, por ejemplo, la aplicación de la Ley de seguridad interior del Estado o la figura de asociación ilícita. Por otra parte, se persiste en la cooptación de dirigencial u organizacional a través de ofrecimientos políticos y económicos, alineándolos así a posturas institucionalizadas y por ende funcionales al sistema de dominación.

agrega un comentario


CRITICA CONSTRUCTIVA
Por CARLOS HAUSER - Friday, Apr. 04, 2003 at 8:17 PM

Con todo el respeto que se merese el pueblo mapuche me atrevo a hacer una critica. Desde hace mucho tiempo vengo observardo que el pueblo mapuche esta librando una nueva "GUERRA" en contra del Estado Chileno, sin embargo ¿no sería mejor unirse a éste para obtener vaneficios y lograr un desarrollo como pueblo en su totalidad para hacerse más poderoso y en ese momento comenzar con una liberación?
PRIMERO SE DEVEN UNIR COMO PUEBLO, LUEGO DESARROLLARSE EN TODO SENTIDO, PRINCIPALMENTE EN LA EDUCACIÓN SIN PERDER LA CULTURA, LUEGO LIBERARSE Y SOLO ASÍ LA AUTONOMIA REAL LLEGARÁ.

agrega un comentario


YA BASTA!!!
Por CARLOS TRUEVA - Friday, Dec. 12, 2003 at 11:12 AM

YO CREO QUE YA BASTA DE TANTA INJUSTICIA, ATROPELLO Y HASTA LA ELABORACION DE UN PLAN DE EXTERMINIO DEL PUEBLO MAPUCHE DIGITADO DESDE EL ESTADO CHILENO, CON LA AYUDA DE LAS TRANSNACIONALES, CON LA UNICA FINALIDAD DE APROVECHARSE DE SUS RIQUEZAS PARA DARSELAS A LOS EXTRANJEROS.

YA ES TIEMPO DE QUE EL PUEBLO MAPUCHE SE LEVANTE, SE ORGANICE Y SE ARME HASTA LOGRAR SU INDEPENDENCIA COMO NACION. LOS BUENOS CHILENOS CONSCIENTES LOS APOYAREMOS.


agrega un comentario


YA BASTA!!!
Por CARLOS TRUEVA - Friday, Dec. 12, 2003 at 11:14 AM

YO CREO QUE YA BASTA DE TANTA INJUSTICIA, ATROPELLO Y HASTA LA ELABORACION DE UN PLAN DE EXTERMINIO DEL PUEBLO MAPUCHE DIGITADO DESDE EL ESTADO CHILENO, CON LA AYUDA DE LAS TRANSNACIONALES, CON LA UNICA FINALIDAD DE APROVECHARSE DE SUS RIQUEZAS PARA DARSELAS A LOS EXTRANJEROS.

YA ES TIEMPO DE QUE EL PUEBLO MAPUCHE SE LEVANTE, SE ORGANICE Y SE ARME HASTA LOGRAR SU INDEPENDENCIA COMO NACION. LOS BUENOS CHILENOS CONSCIENTES LOS APOYAREMOS.


agrega un comentario


IDEALIZACION Y UTOPIA
Por LITTA SOTO - Thursday, Aug. 26, 2004 at 1:59 PM
littaflyhotmail.com 55-53384050

Hablar de lucha indigena muchas veces se confunde con la idelizacion de los indigenas como una sociedad ideal la cual ha tenido que pasar por los sistemas politicos y economicos del mundo moderno. Sin embargo, tambien al hablar de lucha indigena, se viene a la memoria historica el hablar de injusticias, atropellos y violacion a los derechos humanos. Mi opinion es que en el caso mapuche, se han violado a cabalidad los derechos humanos y creo que la unica respuesta posible a ello, es la subversion y la violencia ya que los medios pacificos, no fueron precisamente los aplicados por los gobiernos en torno a la calidad de indigena en Chile.

agrega un comentario


IDEALIZACION Y UTOPIA
Por LITTA SOTO - Thursday, Aug. 26, 2004 at 2:05 PM
littaflyhotmail.com 55-53384050

Hablar de lucha indigena muchas veces se confunde con la idelizacion de los indigenas como una sociedad ideal la cual ha tenido que pasar por los sistemas politicos y economicos del mundo moderno. Sin embargo, tambien al hablar de lucha indigena, se viene a la memoria historica el hablar de injusticias, atropellos y violacion a los derechos humanos. Mi opinion es que en el caso mapuche, se han violado a cabalidad los derechos humanos y creo que la unica respuesta posible a ello, es la subversion y la violencia ya que los medios pacificos, no fueron precisamente los aplicados por los gobiernos en torno a la calidad de indigena en Chile.

agrega un comentario


Identidad mapuche y latinoamericana
Por Litta Soto Villagrán - Sunday, Jul. 30, 2006 at 11:37 PM
littamex@hotmail.com

Sin duda que la identidad ha sido y es uno de los conceptos más aludidos por los indígenas y no indígenas latinoamericanos en este siglo. Corresponde ciertamente a uno de los ejes culturales más recurrentes en los discursos étnicos de la actualidad. Así es posible ver que existen ciertas concordancias en aquellos grupos indígenas latinoamericanos en cuanto a su acepción identitaria. Uno de los elementos que permanecen en dicha comprensión, es la relación con la tierra, entendida ésta desde una perspectiva simbólica. Hasta hoy, los herederos directos de éstas culturas, se reconocen y conocen el mundo en el que habitan a través de una memoria histórica y simbólica en la cual la tierra ocupa un lugar primordial.

agrega un comentario


Situación del Pueblo Mapuche
Por Gerónimo Rosales García - Monday, Jan. 22, 2007 at 10:09 PM
jeronimoarg@hotmail.com

Los aborígenes de América central y del sur están despertando, gracias al Presidente Hugo Chávez de Venezuela, primer país que la Carta Magna establece derechos tácitos a los nativos originales "Indios" además respeta sus lenguas, cultura y espácio geográfico, con iguales derechos ciudadanos. Quiera Dios Bolivia, Ecuador y Nicaragua, reconozcan el sagrado derecho que tienen los dueños genuínos de América no sólo a sus tierras, sinó a convivir en paz y armonía, más temprano que tarde el pueblo Mapuche, alcalzará el espacio que le corresponde, hoy, víctimas de dictaduras y "democracias" !! SIGAN LUCHANDO!! Hermanos, soy Mapuche de alma y corazón.

agrega un comentario


siiii
Por yo - Friday, Apr. 27, 2007 at 1:34 PM

claaaaaro......deben matarse.y NO QUEDA NADIE,..NO TIENE SENTIDO QUE SIGAN ASI

agrega un comentario


guguuuuuuaaaaaaaaauuuuuuuu
Por ana - Tuesday, Aug. 18, 2009 at 3:51 PM
ana_river lo mas_@hotmail.com 4632563 mar del plata

bue m re aburrio pero bueno nada chauuuuuuuuuuuuuuuuuuuu

agrega un comentario


CMI Network: www.indymedia.org Africa: ambazonia canarias estrecho kenya nigeria áfrica del sur Canada: london, ontario maritimes montreal ontario ottawa quebec thunder bay vancouver victoria windsor Asia del Este: burma jakarta japón korea manila qc saint-petersburg Europa: abruzzo alacant andorra anveres armenia atenas austria barcelona belarus bélgica belgrado bristol brussels bulgaria calabria croacia chipre emilia-romagna estrecho euskal herria galiza alemania grenoble hungría irlanda estanbul italia la plana liege liguria lille linksunten lombardia londres madrid malta marseille nantes napoli holanda niza northern england noruega nottingham oost-vlaanderen c.m.i. indymedia paris/Île-de-france patras piemonte polonia portugal roma romania rusia cerdeña escocia suecia suiza torun toscana toulouse ukraine gran bretaña valencia America Latina: argentina bolivia chiapas chile chile sur brasil sucre colombia ecuador méxico peru puerto rico qollasuyu rosario santiago tijuana uruguay valparaiso venezuela Oceania: aotearoa brisbane burma darwin jakarta manila melbourne perth qc sydney Asia del Sur: india mumbai Estados Unidos: arizona arkansas asheville atlanta austin austin baltimore big muddy binghamton boston bufalo charlottesville chicago cleveland colorado columbus washington, dc hawaii houston ny capital ciudad de kansas los ángeles madison maine miami michigan milwaukee minneapolis/st. paul new hampshire nueva jersey nuevo méxico nueva orleans north carolina north texas nyc oklahoma filadelfia pittsburgh portland richmond rochester rogue valley st louis san diego san francisco bahía de san francisco santa barbara santa cruz, ca sarasota seattle tampa bay tennessee urbana-champaign vermont western mass worcester Asia del Oeste: armenia beirut israel palestina proceso: fbi/legal al día listas de correo documentación técnico voluntarios proyectos: impresos radio tv satelital video regiones: estados unidos temas: biotech

Copyleft © 2001-2008 Argentina Centro de Medios Independientes (( i )). Copyleft: Se permite la copia, distribución y uso de los contenidos de Indymedia Argentina, siempre y cuando NO se utilice con fines comerciales, a no ser que se obtenga permiso expreso del autor y en todos los casos se reconozca la autoría (poniendo como fuente http://argentina.indymedia.org ). Las opiniones o artículos vertidos por lxs visitantes o colaboradorxs en el sitio pueden no reflejar las ideas de Indymedia Argentina. Usamos software libre. sf-active v0.9.4 Descargo | Privacidad